Nucleoside Analogs and Nucleoside Precursors as Drugs in the Fight against SARS-CoV-2 and Other Coronaviruses

Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action

Synthesis, self-assembly-behavior and biomolecular recognition properties of thyminyl dipeptides

This article describes the synthesis of Thy-(Phe-Phe) and Thy-(Tyr-Tyr), two thymine-bearing dipeptides based on L-phenylalanine and L-tyrosine, the circular dichroism (CD), UV and dynamic light scattering (DLS) characterization of their self-assemblies, and a CD study of their interaction with nucleic acids (using homoadenine DNA and RNA) and serum proteins (employing BSA as model protein). DLS studies, alongside with CD and UV investigations conducted on aqueous solutions of the derivatives under different concentration and temperature conditions, showed the formation of extensive molecular architectures with hydrodynamic mean diameters higher than 300 nm, with Thy-(Tyr-Tyr) forming at pH=7.5 particularly large and stable networks, involving multiple units, connected by H-bonding, aromatic and hydrophobic interactions. Finally, the findings of our study suggested that Thy-(Phe-Phe) and Thy-(Tyr-Tyr), very stable in human serum, were able to bind BSA protein altering its secondary structure

Exploring the Relationship between G-Quadruplex Nucleic Acids and Plants: From Plant G-Quadruplex Function to Phytochemical G4 Ligands with Pharmaceutic Potential

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies. Herein, we describe some G4 structures found in plants, summarizing the existing knowledge of their functions and biological role. Moreover, we review some of the most promising G4 ligands isolated from vegetal sources and report on the known relationships between such phytochemicals and G4-mediated biological processes that make them potential leads in the pharmaceutical sector

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1′-uracilyl)-2-propanone on Serum Albumin Structure

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δβ-turn + Δβ-sheet = +23.6%, Δα = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the β-structure are consistent with a partial protein destabilization due to the interaction with U2O

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations

Total synthesis of a new stable cyclic ADP-ribose mimic

n/

Summary of the Current Status of DNA Vaccination for Alzheimer Disease

Alzheimer disease (AD) is one of the most common and disabling neuropathies in the ever-growing aged population around the world, that especially affects Western countries. We are in urgent need of finding an effective therapy but also a valid prophylactic means of preventing AD. There is a growing attention currently paid to DNA vaccination, a technology particularly used during the COVID-19 era, which can be used also to potentially prevent or modify the course of neurological diseases, including AD. This paper aims to discuss the main features and hurdles encountered in the immunization and therapy against AD using DNA vaccine technology. Ultimately, this work aims to effectively promote the efforts in research for the development of safe and effective DNA and RNA vaccines for AD

Deciphering the Relationship between SARS-CoV-2 and Cancer

Some viruses are known to be associated with the onset of specific cancers. These microorganisms, oncogenic viruses or oncoviruses, can convert normal cells into cancer cells by modulating the central metabolic pathways or hampering genomic integrity mechanisms, consequently inhibiting the apoptotic machinery and/or enhancing cell proliferation. Seven oncogenic viruses are known to promote tumorigenesis in humans: human papillomavirus (HPV), hepatitis B and C viruses (HBV, HCV), Epstein-Barr virus (EBV), human T-cell leukemia virus 1 (HTLV-1), Kaposi sarcoma-associated herpesvirus (KSHV), and Merkel cell polyomavirus (MCPyV). Recent research indicates that SARS-CoV-2 infection and COVID-19 progression may predispose recovered patients to cancer onset and accelerate cancer development. This hypothesis is based on the growing evidence regarding the ability of SARS-CoV-2 to modulate oncogenic pathways, promoting chronic low-grade inflammation and causing tissue damage. Herein, we summarize the main relationships known to date between virus infection and cancer, providing a summary of the proposed biochemical mechanisms behind the cellular transformation. Mechanistically, DNA viruses (such as HPV, HBV, EBV, and MCPyV) encode their virus oncogenes. In contrast, RNA viruses (like HCV, HTLV-1) may encode oncogenes or trigger host oncogenes through cis-/-trans activation leading to different types of cancer. As for SARS-CoV-2, its role as an oncogenic virus seems to occur through the inhibition of oncosuppressors or controlling the metabolic and autophagy pathways in the infected cells. However, these effects could be significant in particular scenarios like those linked to severe COVID-19 or long COVID. On the other hand, looking at the SARS-CoV-2─cancer relationship from an opposite perspective, oncolytic effects and anti-tumor immune response were triggered by SARS-CoV-2 infection in some cases. In summary, our work aims to recall comprehensive attention from the scientific community to elucidate the effects of SARS-CoV-2 and, more in general, β-coronavirus infection on cancer susceptibility for cancer prevention or supporting therapeutic approaches